This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22772)


Item Catalog # Description Quantity Price (USD)
Plasmid 22772 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    DH5alpha, JM109 high efficiency
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Tag / Fusion Protein
    • ChR2-tdimer2RFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SAlI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

ChR2 seq.5'-3' 870-1796=926bp;
tdimer2RFP 5'-3' 1809-3200=1391bp

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH4-SYN-ChR2-tdimer2RFP was a gift from Thomas Oertner (Addgene plasmid # 22772)
  • For your References section:

    Optical induction of plasticity at single synapses reveals input-specific accumulation of alphaCaMKII. Zhang YP, Holbro N, Oertner TG. Proc Natl Acad Sci U S A. 2008 Aug 19. 105(33):12039-44. 10.1073/pnas.0802940105 PubMed 18697934