Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMH4-SYN-ChR2-tdimer2RFP
(Plasmid #22772)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22772 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMH4
  • Backbone size w/o insert (bp) 7037
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha, JM109 high efficiency
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ChR2-tdimer2RFP
  • Species
    mixture
  • Insert Size (bp)
    2330
  • Tag / Fusion Protein
    • ChR2-tdimer2RFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SAlI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Karl Deisseroth, Stanford; Roger Y. Tsien, San Diego

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ChR2 seq.5'-3' 870-1796=926bp;
tdimer2RFP 5'-3' 1809-3200=1391bp

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH4-SYN-ChR2-tdimer2RFP was a gift from Thomas Oertner (Addgene plasmid # 22772 ; http://n2t.net/addgene:22772 ; RRID:Addgene_22772)
  • For your References section:

    Optical induction of plasticity at single synapses reveals input-specific accumulation of alphaCaMKII. Zhang YP, Holbro N, Oertner TG. Proc Natl Acad Sci U S A. 2008 Aug 19. 105(33):12039-44. 10.1073/pnas.0802940105 PubMed 18697934