1
Plasmid 24559: pFloxin-IRES-Ofd1-Myc
  • Ofd1

  • 3550

  • M. musculus (mouse)

  • NM_177429

  • Ofd1 (ORF2, Cxorf5, DXGgc7e)

  • Myc

  • C terminal on insert

  • pBluescript
    (Search Vector Database)

  • Mouse Targeting, Cre/Lox

  • 4501

  • NheI

  • No

  • ApaI

  • Yes

  • tcggtgcacatgctttacat List of Sequencing Primers

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media

  • Low Copy

  • View sequences (2)
  • View map

  • Jeremy Reiter

  • MTA

Comments: 

Also see the following article:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles.

Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF.

Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Floxin, a resource for genetically engineering mouse ESCs. Singla et al (Nat Methods. 2010 Jan . 7(1):50-2. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24559" in your Materials and Methods section.