Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #24559)


Item Catalog # Description Quantity Price (USD)
Plasmid 24559 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4501
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Ofd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site ApaI (destroyed during cloning)
  • 5′ sequencing primer tcggtgcacatgctttacat
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Also see the following article:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles.

Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF.

Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloxin-IRES-Ofd1-Myc was a gift from Jeremy Reiter (Addgene plasmid # 24559)
  • For your References section:

    Floxin, a resource for genetically engineering mouse ESCs. Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC, Reiter JF. Nat Methods. 2010 Jan . 7(1):50-2. 10.1038/nmeth.1406 PubMed 19966808