1
Plasmid 24728: pHPyV7-713a
  • Full genome of Human polyomavirus 7

  • Polyomavirus HPyV7 isolate 713a

  • 4957

  • polyomavirus

  • HM011566

  • pFunnyfarm
    (Search Vector Database)

  • Christopher Buck lab, Addgene plasmid 24755

  • Viral clone

  • 2131

  • Gateway Cloning

  • attPI

  • Yes

  • AttP2

  • Yes

  • M13/pUC Forward List of Sequencing Primers

  • AsyR (CTGAAAGAGGAACTTGGTTAGG)

  • Bleocin (Zeocin)

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Annotated nucleotide map

  • Christopher Buck

  • MTA

Comments: 

genome can be liberated by digestion with Mfe I.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter et al (Cell Host Microbe. 2010 Jun 25;7(6):509-15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24728" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only