Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LZRS-DNMT1
(Plasmid #24952)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24952 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LZRS
  • Backbone size w/o insert (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DNMT1
  • Species
    H. sapiens (human)
  • Entrez Gene
    DNMT1 (a.k.a. ADCADN, AIM, CXXC9, DNMT, HSN1E, MCMT, m.HsaI)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    full length WT DNMT1 cDNA from Open Biosystems
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS-DNMT1 was a gift from Paul Khavari (Addgene plasmid # 24952 ; http://n2t.net/addgene:24952 ; RRID:Addgene_24952)
  • For your References section:

    DNMT1 maintains progenitor function in self-renewing somatic tissue. Sen GL, Reuter JA, Webster DE, Zhu L, Khavari PA. Nature. 2010 Jan 28. 463(7280):563-7. 10.1038/nature08683 PubMed 20081831