|
Plasmid
25026:
pIS1-miR-126 site
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25026" in your Materials and Methods section. |
Renilla luciferase reporter for miR-126 constructed by cloning oligo containing synthetic miR-126 binding site (GCCATTGAGCTCTCGTACCGTGAGTAATAATGCGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.