Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pIS1-miR-126 site
(Plasmid #25026)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    David Bartel, Addgene plasmid # 12179
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    synthetic miR-126 site
  • Alt name
    miR-126 reporter
  • Insert Size (bp)
    23

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer Rluc-F (ccaggattcttttccaatgc)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Renilla luciferase reporter for miR-126 constructed by cloning oligo containing synthetic miR-126 binding site (GCCATTGAGCTCTCGTACCGTGAGTAATAATGCGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-miR-126 site was a gift from Bob Weinberg (Addgene plasmid # 25026)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507