1
Plasmid 26220: pJFRC7-20XUAS-IVS-mCD8::GFP
  • mCD8::GFP

  • 1389

  • M. musculus (mouse)

  • pJFRC-MUH
    (Search Vector Database)

  • Insect Expression

  • 8151

  • XhoI

  • No

  • XbaI

  • No

  • hsp70 F: GAGCGCCGGAGTATAAATAGAG List of Sequencing Primers

  • SV40 R: CCATTCATCAGTTCCATAGG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Author's PDF Map of pJFRC7-20XUAS-IVS-mCD8::GFP (application/pdf)

  • Gerald Rubin

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer et al (Genetics. 2010 Aug 9. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26220" in your Materials and Methods section.