Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #26220)

Add to Cart
Available to Academic and Nonprofits Only

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC7-20XUAS-IVS-mCD8::GFP was a gift from Gerald Rubin (Addgene plasmid # 26220)
  • For your References section:

    Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123