Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pBPGAL80Uw-4
(Plasmid #26235)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    GAL80
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1308
  • Entrez Gene
    GAL80 (a.k.a. YML051W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer DSCP F: GAGCTCGCCCGGGGATC
  • 3′ sequencing primer GAL80 R: GACTCCGCCTGATCGAGCGAGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPGAL80Uw-4 was a gift from Gerald Rubin (Addgene plasmid # 26235)
  • For your References section:

    Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123