1
Plasmid 26235: pBPGAL80Uw-4
  • GAL80

  • 1308

  • S. cerevisiae (budding yeast)

  • GAL80 (YML051W)

  • pBPGUw
    (Search Vector Database)

  • Insect Expression

  • 9409

  • NheI

  • No

  • HindIII

  • No

  • DSCP F: GAGCTCGCCCGGGGATC List of Sequencing Primers

  • GAL80 R: GACTCCGCCTGATCGAGCGAGC

  • Ampicillin and Chloramphenicol

  • ccdB Survival

  • 37

  • ccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.

  • High Copy

  • View sequences (2)
  • Gerald Rubin

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer et al (Genetics. 2010 Aug 9. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26235" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only