Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26290)


Item Catalog # Description Quantity Price (USD)
Plasmid 26290 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pUC HSP-Delta23
  • Backbone size w/o insert (bp) 6427
  • Vector type
    Bacterial Expression, Insect Expression ; Drosophila transgenesis

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    phiC31 integrase
  • Species
    Streptomyces phage phiC31
  • Insert Size (bp)
  • Entrez Gene
    int (a.k.a. phiC31p51)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcttcgtctacggagcgaca
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

There is one nucleotide deletion in the promoter region of Addgene sequence that does not alter function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS130 was a gift from Tom Clandinin (Addgene plasmid # 26290 ; ; RRID:Addgene_26290)
  • For your References section:

    A versatile in vivo system for directed dissection of gene expression patterns. Gohl D, Silies M, Gao X, Bhalerao S, Luongo F, Lin CC, Potter C, Clandinin T. Nature Methods (2011) doi:10.1038/nmeth.1561 10.1038/nmeth.1561