1
Plasmid 26290: pBS130
  • phiC31 integrase

  • 1839

  • Streptomyces phage phiC31

  • int ()

  • pUC HSP-Delta23
    (Search Vector Database)

  • Bacterial Expression, Insect Expression ; Drosophila transgenesis

  • 6427

  • EcoRI

  • No

  • EcoRI

  • No

  • gcttcgtctacggagcgaca List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Tom Clandinin

  • MTA

Comments: 

There is one nucleotide deletion in the promoter region of Addgene sequence that does not alter function.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A versatile in vivo system for directed dissection of gene expression patterns Gohl et al (Nature Methods (2011) doi:10.1038/nmeth.1561)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26290" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only