1
Plasmid 26798: pEnt L1L3-MCS
  • multiple cloning sequence

  • MCS

  • 200

  • pEntr2B
    (Search Vector Database)

  • Invitrogen

  • Gateway Entry vector

  • 2100

  • Gateway Cloning

  • TCTACAAACTCTTCCTGTTAGT List of Sequencing Primers

  • AGAGATTTTGAGACACGGGC

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (4)
  • View map

  • Edward Hsiao

  • MTA

Comments: 

Empty entry vector carrying Gateway L1L3 sites, with MCS. This plasmid can act as an empty carrier when combined with a R3L2 plasmid to generate expression plasmids carrying just the R3L2 component (i.e., TetO-transgene expressing plasmid)

Plasmid was constructed as follows: The pEntr2B entry vector (Invitrogen) was digested with PstI and XhoI to remove the attL2 site.
Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side
and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites. A LoxP sequence was introduced at the XhoI site.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice Hsiao et al (Stem Cell Res Ther. 2011 Mar 4;2(2):11. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26798" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only