1
Plasmid 26992: Psicheck2 MERTK full length 3'UTR
  • MERTK Full length 3' UTR

  • MERTK

  • 500

  • H. sapiens (human)

  • MERTK (MER, RP38, c-mer)

  • Renilla Luciferase

  • N terminal on insert

  • psiCHECK-2
    (Search Vector Database)

  • Promega

  • Mammalian Expression, Luciferase

  • 6300

  • XhoI

  • No

  • NotI

  • No

  • Rluc-F List of Sequencing Primers

  • psiCHECK2-R (CGAGGTCCGAAGACTCATTT)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Joan Massague

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Endogenous human microRNAs that suppress breast cancer metastasis. Tavazoie et al (Nature. 2008 Jan 10. 451(7175):147-52. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26992" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with