Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLKO.1-MKL1/2 shRNA
(Plasmid #27161)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLKO.1-puro
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    shRNA MKL1+2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer hU6-Fwd
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-MKL1/2 shRNA was a gift from Ron Prywes (Addgene plasmid # 27161)
  • For your References section:

    Activation and repression of cellular immediate early genes by serum response factor cofactors. Lee SM, Vasishtha M, Prywes R. J Biol Chem. 2010 Jul 16. 285(29):22036-49. 10.1074/jbc.M110.108878 PubMed 20466732