1
Plasmid 27161: pLKO.1-MKL1/2 shRNA
  • shRNA MKL1+2

  • 21

  • H. sapiens (human)

  • pLKO.1-puro
    (Search Vector Database)

  • Lentiviral, RNAi

  • AgeI

  • Yes

  • EcoRI

  • No

  • hU6-Fwd List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Ron Prywes

  • MTA

Comments: 

shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Activation and repression of cellular immediate early genes by serum response factor cofactors. Lee et al (J Biol Chem. 2010 Jul 16. 285(29):22036-49. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27161" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only