This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLKO.1-MKL1/2 shRNA
(Plasmid #27161)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 27161 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    shRNA MKL1+2
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer hU6-Fwd
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-MKL1/2 shRNA was a gift from Ron Prywes (Addgene plasmid # 27161)
  • For your References section:

    Activation and repression of cellular immediate early genes by serum response factor cofactors. Lee SM, Vasishtha M, Prywes R. J Biol Chem. 2010 Jul 16. 285(29):22036-49. 10.1074/jbc.M110.108878 PubMed 20466732