pLenti-EF1a-Backbone(NN)
(Plasmid #27961)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9204
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    TAL-Backbone(NN)
  • Alt name
    Backbone(NN)
  • Species
    Synthetic
  • Insert Size (bp)
    2349

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTTGAGTTTGGATCTTGGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1a-Backbone(NN) was a gift from Feng Zhang (Addgene plasmid # 27961)
  • For your References section:

    Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Jan 19. ():. 10.1038/nbt.1775 PubMed 21248753