Plasmid 27961: pLenti-EF1a-Backbone(NN)
  • TAL-Backbone(NN)

  • Backbone(NN)

  • 2349

  • Synthetic

  • pLenti
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 9204

  • BsiWI

  • No

  • EcoRI

  • No

  • TTTTGAGTTTGGATCTTGGT List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (3)
  • Feng Zhang



Please visit www.taleffectors.com for detailed protocols and plasmid maps.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang et al (Nat Biotechnol. 2011 Jan 19. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27961" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only