Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #27961)


Item Catalog # Description Quantity Price (USD)
Plasmid 27961 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9204
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTTGAGTTTGGATCTTGGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit for detailed protocols and plasmid maps.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1a-Backbone(NN) was a gift from Feng Zhang (Addgene plasmid # 27961)
  • For your References section:

    Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Jan 19. ():. 10.1038/nbt.1775 PubMed 21248753