-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 27970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4154
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ccgagggcttcaagtgggagcgc
- 3′ sequencing primer cagcttcaccttgtagatgaactcgc (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-minCMV-mCherry was a gift from Feng Zhang (Addgene plasmid # 27970 ; http://n2t.net/addgene:27970 ; RRID:Addgene_27970) -
For your References section:
Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Jan 19. ():. 10.1038/nbt.1775 PubMed 21248753