pAAV-minCMV-mCherry
(Plasmid #27970)

• Depositing Lab: Feng Zhang
• Publication: Zhang et al Nat Biotechnol. 2011 Jan 19. ():.
• Sequence Information:

  • Depositor Sequences: Full (1)
  • Addgene Sequences: Partial (3)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	27970	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 4154
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ccgagggcttcaagtgggagcgc
• 3′ sequencing primer: cagcttcaccttgtagatgaactcgc

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest on replacement
• Terms and Licenses:
  • UBMTA
  • Clontech Limited Use Label License
• Articles Citing this Plasmid:
  • 2 References

Depositor Comments

Please visit
http://taleffector.genome-engineering.org/ for detailed protocols and plasmid maps.