1
Plasmid 27970: pAAV-minCMV-mCherry
  • mCherry

  • 711

  • Synthetic

  • pAAV
    (Search Vector Database)

  • Mammalian Expression

  • 4154

  • MluI

  • No

  • EcoRI

  • No

  • ccgagggcttcaagtgggagcgc List of Sequencing Primers

  • cagcttcaccttgtagatgaactcgc

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (4)
  • Notes from Addgene (1)

  • Feng Zhang

  • MTA
    Clontech Limited Use Label License

Comments: 

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang et al (Nat Biotechnol. 2011 Jan 19. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27970" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only