Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pAAV-minCMV-mCherry
(Plasmid #27970)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccgagggcttcaagtgggagcgc
  • 3′ sequencing primer cagcttcaccttgtagatgaactcgc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-minCMV-mCherry was a gift from Feng Zhang (Addgene plasmid # 27970)
  • For your References section:

    Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Jan 19. ():. 10.1038/nbt.1775 PubMed 21248753