Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

DECIPHER Lentiviral shRNA Library, Human Mod 2: Disease Targets
(Pooled library #28286)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    Cellecta , Available from Addgene (#28289)
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Plasmids need to be grown in OmniMAX 2 T1R (Life Technologies) or SURE (Agilent) Recombination defective E.coli cells
  • Copy number

Sequence Information

  • Depositor Sequences
  • Addgene Sequences

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
    Disease Targets
  • Alt name
    5,412 targets; 27,500 shRNAs
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Bar-code downstream of shRNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (BpiI) (destroyed during cloning)
  • 3′ cloning site BbsI (BpiI) (destroyed during cloning)
  • 5′ sequencing primer FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Library is supplied as 120μl of DNA at 1.0μg/μl

DECIPHER libraries are bar-coded lentiviral shRNA libraries optimized for RNAi Genetic Screens in pooled format. Human Module 2 can be used for the more comprehensive follow-up screens or simply be done in parallel. There are approximately 10,000 genes that have an Entrez/RefSeq ID and at least one interaction documented in PubMed and cover the majority of disease-associated genes and drug targets. About half of these are included in Module 1 while Module 2 covers the rest.

PLEASE NOTE: The DECIPHER shRNA are designed for target mRNA associated with the RefSeq#, not the HUGO gene symbol. We can't guarantee that the gene symbols indicated are accurate, as there may be synonyms, nomenclature updates/changes, or other discrepancies in naming that are beyond our control. Please see the HUGO Gene Nomenclature Committee website at for more information.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DECIPHER Lentiviral shRNA Library, Human Mod 2: Disease Targets was a gift from Alex Chenchik & Gus Frangou (Addgene plasmid # 28286)