pET StrepII TEV LIC cloning vector (1R)
(Plasmid #29664)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • Strep II-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC tag (destroyed during cloning)
  • 3′ cloning site LIC tag (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable Strep II fusion tag on its N-terminus.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET StrepII TEV LIC cloning vector (1R) was a gift from Scott Gradia (Addgene plasmid # 29664)