|
Plasmid
29664:
pET StrepII TEV LIC cloning vector (1R)
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29664" in your Materials and Methods section. |
This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable Strep II fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/