pET LIC cloning vector for hairpin mRNA (2U-T)
(Plasmid
#29719)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET
- Backbone size (bp) 4750
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- MYFQSNA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site LIC site (destroyed during cloning)
- 3′ cloning site LIC site (destroyed during cloning)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer T7 reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2U-T adds a short polypeptide sequence to the N-terminus of your protein of interest. This may be useful when the native mRNA forms hairpin loops, causing low or no expression.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
The vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET LIC cloning vector for hairpin mRNA (2U-T) was a gift from Scott Gradia (Addgene plasmid # 29719 ; http://n2t.net/addgene:29719 ; RRID:Addgene_29719)