Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pcDNA3 mCherry LIC cloning vector (6B)
(Plasmid #30125)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size (bp) 6136
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 3′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
  • 3′ sequencing primer mCherry reverse (5'gcaccttgaagcgcatgaact)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This is an empty LIC vector derived from pcDNA3. It adds an mCherry gene to the C-terminus of your protein of interest.

mCherry has a excitation max of 587 nm and an emission max of 610 nm.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 mCherry LIC cloning vector (6B) was a gift from Scott Gradia (Addgene plasmid # 30125)