1
Plasmid 30125: pcDNA3 mCherry LIC cloning vector (6B)
  • Empty LIC vector; adds an mCherry gene to the C-terminus of your protein of interest.

  • None

  • mCherry

  • C terminal on backbone

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 6136

  • LIC site vKoz/GFP

  • Yes

  • LIC site vKoz/GFP

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • mCherry reverse (5'gcaccttgaagcgcatgaact)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • Scott Gradia

  • UBMTA
    Clontech Limited Use Label License
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

This is an empty LIC vector derived from pcDNA3. It adds an mCherry gene to the C-terminus of your protein of interest.

mCherry has a excitation max of 587 nm and an emission max of 610 nm.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30125" in your Materials and Methods section.