Plasmid 30125: pcDNA3 mCherry LIC cloning vector (6B)
  • Empty LIC vector; adds an mCherry gene to the C-terminus of your protein of interest.

  • None

  • mCherry

  • C terminal on backbone

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 6136

  • LIC site vKoz/GFP

  • Yes

  • LIC site vKoz/GFP

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • mCherry reverse (5'gcaccttgaagcgcatgaact)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Scott Gradia

  • MTA
    Clontech Limited Use Label License


This is an empty LIC vector derived from pcDNA3. It adds an mCherry gene to the C-terminus of your protein of interest.

mCherry has a excitation max of 587 nm and an emission max of 610 nm.

To clone into this vector, add the following tags to your PCR primers:



Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30125" in your Materials and Methods section.