-
Purpose(Empty Backbone) Empty LIC vector; adds an mCherry gene to the C-terminus of your protein of interest.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 30125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
Cloning Grade DNA | 30125-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $95 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Backbone size (bp) 6136
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site LIC site vKoz/GFP (destroyed during cloning)
- 3′ cloning site LIC site vKoz/GFP (destroyed during cloning)
- 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
- 3′ sequencing primer mCherry reverse (5'gcaccttgaagcgcatgaact) (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Reference
-
Articles Citing this Plasmid
Depositor Comments
This is an empty LIC vector derived from pcDNA3. It adds an mCherry gene to the C-terminus of your protein of interest.
mCherry has a excitation max of 587 nm and an emission max of 610 nm.
To clone into this vector, add the following tags to your PCR primers:
LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)
LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC
Do NOT include a stop codon with your reverse primer.
T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Information for Cloning Grade DNA (Catalog # 30125-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $95 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 mCherry LIC cloning vector (6B) was a gift from Scott Gradia (Addgene plasmid # 30125 ; http://n2t.net/addgene:30125 ; RRID:Addgene_30125)