pcDNA3 LIC cloning vector (6A)
(Plasmid #30124)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size (bp) 5407
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
  • 3′ sequencing primer CMV R (5'tggctggcaactagaagg)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This is a LIC vector derived from pcDNA3. It adds no tags to your protein of interest.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LicV1 Reverse tag 5’-TTATCCACTTCCAATGTTATTA

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 LIC cloning vector (6A) was a gift from Scott Gradia (Addgene plasmid # 30124)