1
Plasmid 30124: pcDNA3 LIC cloning vector (6A)
  • None

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 5407

  • LIC site

  • Yes

  • LIC site

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • CMV R (5'tggctggcaactagaagg)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Scott Gradia

  • UBMTA

Comments: 

This is a LIC vector derived from pcDNA3. It adds no tags to your protein of interest.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LicV1 Reverse tag 5’-TTATCCACTTCCAATGTTATTA

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30124" in your Materials and Methods section.