1
Plasmid 30124: pcDNA3 LIC cloning vector (6A)
  • None

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 5407

  • LIC site

  • Yes

  • LIC site

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • CMV R (5'tggctggcaactagaagg)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Scott Gradia

  • UBMTA

Comments: 

This is a LIC vector derived from pcDNA3. It adds no tags to your protein of interest.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LicV1 Reverse tag 5’-TTATCCACTTCCAATGTTATTA

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30124" in your Materials and Methods section.