This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3 LIC cloning vector (6A)
(Plasmid #30124)


Item Catalog # Description Quantity Price (USD)
Plasmid 30124 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 5407
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
  • 3′ sequencing primer CMV R (5'tggctggcaactagaagg)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This is a LIC vector derived from pcDNA3. It adds no tags to your protein of interest.

To clone into this vector, add the following tags to your PCR primers:



T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 LIC cloning vector (6A) was a gift from Scott Gradia (Addgene plasmid # 30124)