This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3 mCerulean LIC cloning vector (6E)
(Plasmid #30128)

Item Catalog # Description Quantity Price (USD)
Plasmid 30128 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
  • Backbone size (bp) 6145
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

  • Gene/Insert name
  • Tag / Fusion Protein
    • mCerulean (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 3′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
  • 3′ sequencing primer GFP reverse (5'cagctcgaccaggatgggc3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest.

mCerulean has a excitation max of 435 nm and an emission max of 477 nm.

To clone into this vector, add the following tags to your PCR primers:

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 mCerulean LIC cloning vector (6E) was a gift from Scott Gradia (Addgene plasmid # 30128)