1
Plasmid 30128: pcDNA3 mCerulean LIC cloning vector (6E)
  • None

  • mCerulean

  • C terminal on backbone

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 6145

  • LIC site vKoz/GFP

  • Yes

  • LIC site vKoz/GFP

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • GFP reverse (5'cagctcgaccaggatgggc3')

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Scott Gradia

  • Vanderbilt-Cerulean
    UBMTA

Comments: 

This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest.

mCerulean has a excitation max of 435 nm and an emission max of 477 nm.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30128" in your Materials and Methods section.