1
Plasmid 30128: pcDNA3 mCerulean LIC cloning vector (6E)
  • None

  • mCerulean

  • C terminal on backbone

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 6145

  • LIC site vKoz/GFP

  • Yes

  • LIC site vKoz/GFP

  • Yes

  • CMV F (5'cgcaaatgggcggtaggcgtg) List of Sequencing Primers

  • GFP reverse (5'cagctcgaccaggatgggc3')

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Scott Gradia

  • Vanderbilt-Cerulean
    UBMTA

Comments: 

This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest.

mCerulean has a excitation max of 435 nm and an emission max of 477 nm.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30128" in your Materials and Methods section.