Addgene - pET LIC cloning vector for hairpin mRNA (2U-T) Plasmid Data

Plasmid 29719: pET LIC cloning vector for hairpin mRNA (2U-T)

Gene/insert name:
None
Fusion protein or tag:
MYFQSNA
Terminal:
N terminal on backbone
Vector backbone:
pET
(Search Vector Database)
Vector type:
Bacterial Expression
Backbone size (bp):
4750
Cloning site 5':
LIC site
Site destroyed during cloning:
Yes
Cloning site 3':
LIC site
Site destroyed during cloning:
Yes
5' sequencing primer:
T7 forward List of Sequencing Primers
3' sequencing primer:
T7 reverse
Bacterial resistance(s)
Ampicillin
Growth strain(s)
DH5alpha
Growth temperature (℃):
37
High or low copy:
Low Copy
Sequence: View sequences (2)
Map:
View map
Principal Investigator:
Scott Gradia
Terms and Licenses:
MTA
EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter

Comments:

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2U-T adds a short polypeptide sequence to the N-terminus of your protein of interest. This may be useful when the native mRNA forms hairpin loops, causing low or no expression.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

The vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29719" in your Materials and Methods section.