1
Plasmid 29749: pET MBP mCitrine LIC cloning vector (MBP-mCitrine)
  • None

  • Biotin - His6 - MBP -TEV

  • N terminal on backbone

  • mCitrine

  • C terminal on backbone

  • pET
    (Search Vector Database)

  • Bacterial Expression

  • 7276

  • LIC site vGFP

  • Yes

  • LIC site vGFP

  • Yes

  • MBP forward (5'ggtcgtcagactgtcgatgaagcc) List of Sequencing Primers

  • GFP reverse (5'cagctcgaccaggatgggc3')

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (3)
  • View map

  • Scott Gradia

  • MTA
    EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter

Comments: 

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.

mCitrine has a excitation max of 515 nm and an emission max of 529 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'CTCCCACTACCAATGCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with SspI, then gel purify.

When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29749" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with
18696: mEGFP
36084: pLV-mCherry