Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #30498)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 30498 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Beclin, Barkor
  • Alt name
    ATG6; ATG14L/ATG14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Beclin 1 + 413-492 aa of Barkor
  • GenBank ID
    AF139131 KIAA0831
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Tags / Fusion Proteins
    • hrGFP (N terminal on backbone)
    • 3xFlag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Beclin-BATS was a gift from Qing Zhong (Addgene plasmid # 30498 ; ; RRID:Addgene_30498)
  • For your References section:

    Autophagosome targeting and membrane curvature sensing by Barkor/Atg14(L). Fan W, Nassiri A, Zhong Q. Proc Natl Acad Sci U S A. 2011 Apr 25. ():. 10.1073/pnas.1016472108 PubMed 21518905