This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSicoR-mCh-GFPi
(Plasmid #21905)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21905 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSicoR
  • Backbone size w/o insert (bp) 7558
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFPi
  • Alt name
    shRNA GFP
  • Insert Size (bp)
    55

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cacagacttgtgggagaagc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

GFP RNAi sequence - 5'-ACAGCCACAACGTCTATAT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR-mCh-GFPi was a gift from Miguel Ramalho-Santos (Addgene plasmid # 21905)
  • For your References section:

    Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia A, Alajem A, Polesso F, Sridharan R, Mason MJ, Heidersbach A, Ramalho-Santos J, McManus MT, Plath K, Meshorer E, Ramalho-Santos M. Nature. 2009 Jul 8. ():. 10.1038/nature08212 PubMed 19587682