Plasmid 21904: pSicoR-mCh-Chd1i1
  • Chd1-i1

  • shRNA-i1 Chd1

  • 55

  • M. musculus (mouse)

  • pSicoR
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi

  • 7558

  • HpaI

  • Yes

  • XhoI

  • No

  • cacagacttgtgggagaagc List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • View sequences (3)
  • Miguel Ramalho-Santos




Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia et al (Nature. 2009 Jul 8. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21904" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only