Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pSicoR-mCh-Chd1i1
(Plasmid #21904)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pSicoR
  • Backbone size w/o insert (bp) 7558
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    Chd1-i1
  • Alt name
    shRNA-i1 Chd1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    55

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cacagacttgtgggagaagc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Chd1 RNAi1 sequence 5'-ACATTATGATGGAGCTAAA

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR-mCh-Chd1i1 was a gift from Miguel Ramalho-Santos (Addgene plasmid # 21904)
  • For your References section:

    Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia A, Alajem A, Polesso F, Sridharan R, Mason MJ, Heidersbach A, Ramalho-Santos J, McManus MT, Plath K, Meshorer E, Ramalho-Santos M. Nature. 2009 Jul 8. ():. 10.1038/nature08212 PubMed 19587682