pSicoR-mCh-empty
(Plasmid #21907)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pSicoR
  • Backbone size (bp) 7558
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cacagacttgtgggagaagc
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR-mCh-empty was a gift from Miguel Ramalho-Santos (Addgene plasmid # 21907)
  • For your References section:

    Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia A, Alajem A, Polesso F, Sridharan R, Mason MJ, Heidersbach A, Ramalho-Santos J, McManus MT, Plath K, Meshorer E, Ramalho-Santos M. Nature. 2009 Jul 8. ():. 10.1038/nature08212 PubMed 19587682