1
Plasmid 31031: pTAL1
  • TALE

  • 2101

  • Xanthamonas oryzae

  • pCR8-GW modified
    (Search Vector Database)

  • Invitrogen

  • 2676

  • TAL_F1 (ttggcgtcggcaaacagtgg) List of Sequencing Primers

  • TAL_R2 (ggcgacgaggtggtcgttgg)

  • Ampicillin (50 ug/ml)

  • DH5alpha

  • 37

  • DH10B/LB+antibiotics

  • High Copy

  • View sequences (3)
  • Adam Bogdanove

  • Daniel Voytas

  • MTA
    Cellectis Limited Use Label License

Comments: 

Gateway compatible vector for assembly of full-length TAL effector genes by Golden Gate cloning. Contains both SD and Kozak sequences immediately upstream of the initial ATG. Designed for TAL DNA-binding domains alone

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak et al (Nucleic Acids Res. 2011 Apr 14. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31031" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only