pTAL3
(Plasmid
#31034)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDW1789
- Backbone size w/o insert (bp) 5582
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a/LB+antibiotics
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN-FokI nuclease backbone
-
SpeciesXanthamonas oryzae
-
Insert Size (bp)1948
-
Tags
/ Fusion Proteins
- FokI nuclease (C terminal on insert)
- AcV5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TEF_seq (ggtcttcaatttctcaagtttc) TAL_F1 (ttggcgtcggcaaacagtgg)
- 3′ sequencing primer homodimer_rev (aattcagatttcactagctg) TAL_R2 (ggcgacgaggtggtcgttg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression of the TAL-FokI homodimer in yeast.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTAL3 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31034 ; http://n2t.net/addgene:31034 ; RRID:Addgene_31034) -
For your References section:
Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687