1
Plasmid 31034: pTAL3
  • TALEN-FokI nuclease backbone

  • 1948

  • Xanthamonas oryzae

  • FokI nuclease

  • C terminal on insert

  • AcV5

  • pDW1789
    (Search Vector Database)

  • 5582

  • BamHI

  • No

  • BamHI

  • No

  • TEF_seq (ggtcttcaatttctcaagtttc) TAL_F1 (ttggcgtcggcaaacagtgg) List of Sequencing Primers

  • homodimer_rev (aattcagatttcactagctg) TAL_R2 (ggcgacgaggtggtcgttg

  • Ampicillin (50 ug/ml)

  • DH5alpha

  • 37

  • DH5a/LB+antibiotics

  • High Copy

  • HIS3

  • View sequences (7)
  • Adam Bogdanove

  • Daniel Voytas

  • MTA
    Cellectis Limited Use Label License

Comments: 

Expression of the TAL-FokI homodimer in yeast.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak et al (Nucleic Acids Res. 2011 Apr 14. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31034" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only