pS3aG
(Plasmid
#31171)
-
Purpose(Empty Backbone) A Drosophila GFP reporter transgene vector for site-specific integration
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN/A
- Backbone size (bp) 10930
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha, standard LB
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CACATGTGCAAGAGAACCCAGTG
- 3′ sequencing primer CTGCGCTTGTTTATTTGCTTAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
284 bp attB recombination sequence
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS3aG was a gift from Thomas Williams (Addgene plasmid # 31171 ; http://n2t.net/addgene:31171 ; RRID:Addgene_31171) -
For your References section:
The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Williams TM, Selegue JE, Werner T, Gompel N, Kopp A, Carroll SB. Cell. 2008 Aug 22;134(4):610-23. doi: 10.1016/j.cell.2008.06.052. 10.1016/j.cell.2008.06.052 PubMed 18724934