1
Plasmid 31171: S3aG, a Drosophila GFP reporter transgene vector for site-specif
  • None

  • N/A
    (Search Vector Database)

  • Insect Expression

  • 10930

  • CACATGTGCAAGAGAACCCAGTG List of Sequencing Primers

  • CTGCGCTTGTTTATTTGCTTAGC

  • Ampicillin

  • DH5alpha

  • 37

  • DH5alpha, standard LB

  • High Copy

  • View sequences (3)
  • Thomas Williams

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31171" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with