The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT
The shRNA is downstream of the EGFP GGATAATCGTT
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
31500" in your Materials and Methods section.
The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT
The shRNA is downstream of the EGFP
GGATAATCGTT