1
Plasmid 31500: pSLIK sh human Rb 1534 hyg
  • RB shRNA

  • RB1

  • H. sapiens (human)

  • RB1 (RP11-174I10.1, OSRC, RB, p105-Rb, pRb, pp110)

  • EGFP

  • N terminal on backbone

  • The target sequence for shRB 1534 is GAACGATTATCCATTCAAA

  • pSLIK-EGFP
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi

  • 13700

  • n/a List of Sequencing Primers

  • EGFP-C

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3

  • Unknown

  • Hygromycin

  • View sequences (2)
  • Julien Sage

  • MTA

Comments: 

The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT

The shRNA is downstream of the EGFP
GGATAATCGTT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31500" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only