Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #31981)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 31981 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pTriEx 3
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human); Avena sativa (oat)
  • Insert Size (bp)
  • Tag / Fusion Protein
    • RFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Cloning primers:
5' end:
3' end:

LOVS1K should be co-expressed with Orai1, such as Orai1 CFP ( or Orai1 YFP ( deposited by Anjana Rao.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LOVS1K was a gift from Kevin Truong (Addgene plasmid # 31981 ; ; RRID:Addgene_31981)
  • For your References section:

    A synthetic photoactivated protein to generate local or global ca(2+) signals. Pham E, Mills E, Truong K. Chem Biol. 2011 Jul 29;18(7):880-90. 10.1016/j.chembiol.2011.04.014 PubMed 21802009