-
Depositing Lab
-
Publication
-
Sequence Information
-
Depositor Sequences: Full (1)
-
Addgene Sequences: Partial (2)
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 32132 | Plasmid sent as bacteria in agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC7-20XUAS-IVS-mCD8::GFP
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlippase1::PEST
-
SpeciesS. cerevisiae (budding yeast)
-
MutationAspartic Acid at Amino Acid 5
-
Tag
/ Fusion Protein
- PEST (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC150-20XUAS-IVS-Flp1::PEST was a gift from Gerald Rubin (Addgene plasmid # 32132) -
For your References section:
Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835