Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJFRC151-3XUAS-IVS-Flp2::PEST
(Plasmid #32133)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32133 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJFRC4-3XUAS-IVS-mCD8::GFP
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Flippase2::PEST
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Glycine at Amino Acid 5
  • Tag / Fusion Protein
    • PEST (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho (not destroyed)
  • 3′ cloning site Xba (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC151-3XUAS-IVS-Flp2::PEST was a gift from Gerald Rubin (Addgene plasmid # 32133 ; http://n2t.net/addgene:32133 ; RRID:Addgene_32133)
  • For your References section:

    Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835