Plasmid 32146: pJFRC173-20XUAS-IVS-Dre::PEST
  • Dre::PEST

    (Search Vector Database)

  • Insect Expression

  • XhoI

  • No

  • XbaI

  • No

  • hsp70 F: GAGCGCCGGAGTATAAATAGAG List of Sequencing Primers

  • Ampicillin

  • Top10/P3

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Gerald Rubin


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Multiple new site-specific recombinases for use in manipulating animal genomes. Nern et al (Proc Natl Acad Sci U S A. 2011 Aug 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32146" in your Materials and Methods section.