pJFRC176-10XUAS-rox>-dSTOP-rox>-myr::GFP
(Plasmid
#32147)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC2-10XUAS-IVS-mCD8::GFP
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerox> STOP STOP rox>
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl2 (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC176-10XUAS-rox>-dSTOP-rox>-myr::GFP was a gift from Gerald Rubin (Addgene plasmid # 32147 ; http://n2t.net/addgene:32147 ; RRID:Addgene_32147) -
For your References section:
Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835