Plasmid 32244: pGL3Basic-miR126-EGFL7-Promoter
  • miR-126 Promoter 5' UTR

  • EGFL7 Promoter 5' UTR

  • 1770

  • H. sapiens (human)

  • Promoter region 5' UTR

  • pGL3Basic
    (Search Vector Database)

  • Promega

  • Mammalian Expression, Luciferase

  • 4818

  • 5' UTR

  • Ligation Independent Cloning

  • GCCTGCTGCCAACTTGTTCT List of Sequencing Primers


  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (1)
  • Charles Lowenstein

    Luciferase Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells. Harris et al (Arterioscler Thromb Vasc Biol. 2010 Oct;30(10):1990-7. Epub 2010 Jul 29. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32244" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only