1
Plasmid 32370: pGL3Basic-Mdm2-T4
  • Mdm2 promoter

  • 244

  • M. musculus (mouse)

  • Mdm2 (1700007J15Rik, AA415488, Mdm-2)

  • pGL3Basic
    (Search Vector Database)

  • Promega

  • Mammalian Expression

  • 4818

  • TOPO Cloning

  • CTAGCAAAATAGGCTGTCCC List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (1)
  • Hong Wu

  • MTA
    Luciferase Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: PTEN regulates Mdm2 expression through the P1 promoter. Chang et al (J Biol Chem. 2004 Jul 9;279(28):29841-8. Epub 2004 Apr 16. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32370" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only