1
Plasmid 32396: pscAAV-GFP
  • GFP

  • pSub201
    (Search Vector Database)

  • Mammalian Expression ; Adeno-Associated Virus

  • 8310

  • CMV

  • Multiple (see map)

  • No

  • Multiple (see map)

  • No

  • TGGCACCAAAATCAACGGGACTTTCCAAAATGT List of Sequencing Primers

  • AAAACCTCCCACACCTCCCCCTGAAC

  • Ampicillin

  • Stbl2

  • 37

  • Users must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) An AhdI digest should produce the following pattern of bands: 1557 bp, 1478 bp and 1334 bp. (2) An SrfI digest should produce the following pattern of bands: 2801 bp and 1546 bp. Please consult the associated publication listed below for an example gel image.

  • Low Copy

  • View sequences (2)
  • View map

  • John_T Gray

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Design and Construction of Functional AAV Vectors. Gray et al (Methods Mol Biol. 2011;807:25-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32396" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only