This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

rAAV-syn::FLEX-rev::PSAML141F,Y115F:GlyR-IRES-GFP
(Plasmid #32481)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32481 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 5100
  • Vector type
    AAV, Cre/Lox ; Adeno-associated virus, FLEX switch

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PSAML141F,Y115F-GlyR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2643
  • Promoter Synapsin
  • Tag / Fusion Protein
    • IRES-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site speI blunt (destroyed during cloning)
  • 3′ cloning site SpeI blunt (destroyed during cloning)
  • 5′ sequencing primer gtaagtatcaaggttacaag
  • 3′ sequencing primer ctgacaacgggccacaactc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Comments:
These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.

In Magnus et al, the PSAMY115F,L141F-GlyR channel was emphasized for silencing because this channel has the lowest acetylcholine responsiveness. However, PSAML141F-GlyR constructs, lacking the Y115F mutation, already have low ACh potency. The Y115F mutation also slightly increases the EC50 for the activator ligand, PSEM89S. Since PSAML141F-GlyR constructs already have very low acetylcholine potency, in many cases it may not be worth the slight reduction in PSEM potency. We have made both constructs available for researchers who may find that they have different requirements with respect to acetylcholine responsiveness.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rAAV-syn::FLEX-rev::PSAML141F,Y115F:GlyR-IRES-GFP was a gift from Scott Sternson (Addgene plasmid # 32481 ; http://n2t.net/addgene:32481 ; RRID:Addgene_32481)
  • For your References section:

    Chemical and genetic engineering of selective ion channel-ligand interactions. Magnus CJ, Lee PH, Atasoy D, Su HH, Looger LL, Sternson SM. Science. 2011 Sep 2;333(6047):1292-6. 10.1126/science.1206606 PubMed 21885782