1
Plasmid 32477: rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
  • PSAML141F,Y115F-5HT3HC

  • 2763

  • H. sapiens (human), M. musculus (mouse)

  • IRES-EGFP

  • C terminal on insert

  • AAV2
    (Search Vector Database)

  • Cre/Lox ; Adeno-associated virus, FLEX switch

  • 5100

  • WPRE (Woodchuck hepatitis virus posttranscriptional regulatory element) before polyA sequence

  • Synapsin

  • speI blunt

  • Yes

  • SpeI blunt

  • Yes

  • gtatcaaggttacaagacag List of Sequencing Primers

  • gagttgtggcccgttgtcag

  • Ampicillin

  • Stbl2

  • 30

  • Low Copy

  • View sequences (4)
  • View map

  • Scott Sternson

  • MTA

Comments: 

These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Chemical and genetic engineering of selective ion channel-ligand interactions. Magnus et al (Science. 2011 Sep 2;333(6047):1292-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32477" in your Materials and Methods section.