1
Plasmid 32809: pLemiR-NS
  • non-specific hairpin

  • 350

  • pLemiR
    (Search Vector Database)

  • Open Biosystems

  • Lentiviral

  • 11315

  • Ligation Independent Cloning

  • GATAACTCGACTGTTTGAATGAGGC List of Sequencing Primers

  • AGGGAGAGGGGCGGAATTTG

  • Ampicillin

  • Stbl3

  • 30

  • High Copy

  • Puromycin

  • Open Biosystem

  • View sequences (3)
  • Jerry Crabtree

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo et al (Nature. 2011 Jul 13. doi: 10.1038/nature10323. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32809" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only