POPTOP
(Plasmid #34848)

• Depositing Lab: Paul Sternberg
• Publication: Green et al Cell. 2008 Aug 22;134(4):646-56.

Backbone

• Vector backbone: pJIM20
• Backbone size w/o insert (bp): 8000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TCF binding sites
• Insert Size (bp): 70
• Mutation: The TCF binding site is: AGATCAAAGG
• Promoter: pes-10 minimal promoter
• Tags / Fusion Proteins:
  • mCherry (C terminal on backbone)
  • let-858 3'UTR (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (unknown if destroyed)
• 3′ cloning site: AvrII (unknown if destroyed)
• 5′ sequencing primer: N/A
• 3′ sequencing primer: EGFP-N, T3

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII.

There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.