POPTOP
(Plasmid
#34848)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJIM20
- Backbone size w/o insert (bp) 8000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCF binding sites
-
Insert Size (bp)70
-
MutationThe TCF binding site is: AGATCAAAGG
- Promoter pes-10 minimal promoter
-
Tags
/ Fusion Proteins
- mCherry (C terminal on backbone)
- let-858 3'UTR (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site AvrII (unknown if destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer EGFP-N, T3 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII.
There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POPTOP was a gift from Paul Sternberg (Addgene plasmid # 34848 ; http://n2t.net/addgene:34848 ; RRID:Addgene_34848) -
For your References section:
Opposing Wnt pathways orient cell polarity during organogenesis. Green JL, Inoue T, Sternberg PW. Cell. 2008 Aug 22;134(4):646-56. 10.1016/j.cell.2008.06.026 PubMed 18724937