1
Plasmid 34901: p6608 MSCV-IP N-HAonly CHAF1B
  • CHAF1B

  • H. sapiens (human)

  • CHAF1B (CAF-1, CAF-IP60, CAF1, CAF1A, CAF1P60, MPHOSPH7, MPP7)

  • HA

  • N terminal on backbone

  • MSCV-IP N-HA only
    (Search Vector Database)

  • Gateway

  • Mammalian Expression, Retroviral

  • 8100

  • (NTap mod. by E.White to remove Flag)

  • MSCV LTR

  • Gateway Cloning

  • 5' CTACATCGTGACCTGGGAAGC 3' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Peter Howley

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White et al (Proc Natl Acad Sci U S A. 2012 Jan 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 34901" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only