paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherry
(Plasmid #34911)

• Depositing Lab: Jinhyun Kim
• Publication: Kim et al Nat Methods. 2011 Dec 4;9(1):96-102. doi: 10.1038/nmeth.1784.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	34911	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: paavCAG
  (Search Vector Database)
• Backbone size w/o insert (bp): 5000
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: presynaptic mGRASP
• Alt name: pre-mGRASP
• Species: M. musculus (mouse)
• Insert Size (bp): 1722
• GenBank ID: JN898961
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gcggctctagagcctctgcta
• 3′ sequencing primer: ttaaagcagcgtatccacat

Resource Information

• Terms and Licenses:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Vanderbilt-Cerulean
• Industry Terms:
  • Not Available to Industry
• Articles Citing this Plasmid:
  • 2 References