-
PurposeJxON-post
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepaavCAG
- Backbone size w/o insert (bp) 5000
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepostsynaptic mGRASP
-
Alt namepost-mGRASP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1722
-
GenBank IDJN898960
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcggctctagagcctctgcta
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
paavCAG-Jx-rev-post-mGRASP-2A-dTomato was a gift from Jinhyun Kim (Addgene plasmid # 34913 ; http://n2t.net/addgene:34913 ; RRID:Addgene_34913) -
For your References section:
mGRASP enables mapping mammalian synaptic connectivity with light microscopy. Kim J, Zhao T, Petralia RS, Yu Y, Peng H, Myers E, Magee JC. Nat Methods. 2011 Dec 4;9(1):96-102. doi: 10.1038/nmeth.1784. 10.1038/nmeth.1784 PubMed 22138823