Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51903)


Item Catalog # Description Quantity Price (USD)
Plasmid 51903 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    presynaptic mGRASP
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer gcggctctagagcctctgcta
  • 3′ sequencing primer ttaaagcagcgtatccacat
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that there may be a few sequence discrepancies between Addgene's NGS results for this plasmid and the reference map provided by the depositing lab. These changes are in the backbone region outside of the viral cassette and should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    paavCAG-JxON-pre-mGRASP-mCerulean was a gift from Jinhyun Kim (Addgene plasmid # 51903 ; ; RRID:Addgene_51903)
  • For your References section:

    Structured Synaptic Connectivity between Hippocampal Regions. Druckmann S, Feng L, Lee B, Yook C, Zhao T, Magee JC, Kim J. Neuron. 2014 Feb 5;81(3):629-40. doi: 10.1016/j.neuron.2013.11.026. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.026 PubMed 24412418