humanMER20MER39
(Plasmid
#35256)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePGL4.70
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4000
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMER20/MER39
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
- Promoter dPRL promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NHEI (unknown if destroyed)
- 3′ cloning site BGLII (unknown if destroyed)
- 5′ sequencing primer GAGGAGGCTAGCGGTTTTTCAAAAGCAGCACTAC
- 3′ sequencing primer CTCCTCAGATCTTGTAGGGGAGAAGAGATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
humanMER20MER39 was a gift from Gunter Wagner (Addgene plasmid # 35256 ; http://n2t.net/addgene:35256 ; RRID:Addgene_35256) -
For your References section:
Transformation of a transposon into a derived prolactin promoter with function during human pregnancy. Emera D, Wagner GP. Proc Natl Acad Sci U S A. 2012 Jul 10;109(28):11246-51. doi: 10.1073/pnas.1118566109. Epub 2012 Jun 25. 10.1073/pnas.1118566109 PubMed 22733751