1
Plasmid 35490: FOP-GFP
  • 7xFOP-GFP

  • Synthetic

  • pRRLSIN.cPPT.PGK-GFP.WPRE
    (Search Vector Database)

  • Didier Trono

  • Mammalian Expression, Lentiviral

  • mutated 7xTCF/LEF

  • EcoRV

  • No

  • BamH1

  • No

  • CGTCGCCGTCCAGCTCGACCAG List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Low Copy

  • In this plasmid, a synthetic mutated 7xTCF/LEF promoter sequence replaces the promoter sequence of the 7xTOP-GFP vector.

  • View sequences (2)
  • Ramesh Shivdasani

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst et al (Cancer Res. 2012 Feb 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35490" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only