1
Plasmid 35489: TOP-GFP
  • 7xTOP-GFP

  • pRRLSIN.cPPT.PGK-GFP.WPRE
    (Search Vector Database)

  • Didier Trono

  • Mammalian Expression, Lentiviral

  • 7xTCF/LEF

  • EcoRV

  • No

  • BamH1

  • No

  • CGTCGCCGTCCAGCTCGACCAG List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • This plasmid is very low copy and may require longer incubation times

  • Low Copy

  • We inserted the 7xTCF/LEF promoter cassette from the M50 Super-TOP flash plasmid (Randall Moon) into the pRRLSIN.cPPT.PGK-GFP.WPRE vector (Didier Trono), replacing the PGK promoter.

  • View sequences (2)
  • Ramesh Shivdasani

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst et al (Cancer Res. 2012 Feb 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35489" in your Materials and Methods section.