pAAVsc CB6PI Gpluc7XmiR-122T
(Plasmid
#35647)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 35647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVscCBPIGpluc
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7 bulged miR-122 target sites
-
SpeciesSynthetic
-
Insert Size (bp)156
- Promoter CB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BCLI (destroyed during cloning)
- 3′ cloning site BCLI (destroyed during cloning)
- 5′ sequencing primer cctacgaaggcgacaaagag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVsc CB6PI Gpluc7XmiR-122T was a gift from Phillip Zamore (Addgene plasmid # 35647 ; http://n2t.net/addgene:35647 ; RRID:Addgene_35647)