pAAVscCBPITuDlet-7Gpluc7x122BT
(Plasmid
#35650)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 35650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVsc CB6PI Gpluc7XmiR-122BT
- Backbone size w/o insert (bp) 4903
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTuD let-7
-
SpeciesSynthetic
-
Insert Size (bp)463
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PpuMI (destroyed during cloning)
- 3′ cloning site PpuMI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVscCBPITuDlet-7Gpluc7x122BT was a gift from Phillip Zamore (Addgene plasmid # 35650 ; http://n2t.net/addgene:35650 ; RRID:Addgene_35650)